FASTQ format basics

Each read is in 4 lines:

1. Identifier line – starts with @ and gives a unique read ID, usually with flowcell/lane/tile info.
2. Sequence line – the actual base calls (A, T, G, C, sometimes N for unknown).
3. Separator line – just + (sometimes repeats the ID, but here it doesn’t).
4. Quality line – ASCII characters encoding Phred quality scores (one character per base).

HBR_1_R1.fq

@HWI-ST718_146963544:7:2201:16660:89809/1
CAAAGAGAGAAAGAAAAGTCAATGATTTTATAGCCAGGCAAAATGACTTTCAAGTAAAAAATATAAAGCACCTTACAAACTAGTATCAAAATGCATTTCT
+
CCCFFFFFHHHHHJJJJJHIHIJJIJJJJJJJJJJJJIJJJJJJJJJJJJJIJJIIJJJJJJJJJJJJIIJFHHHEFFFFFEEEEEEEDDDDCDDEEDEE

• ID: HWI-ST718_146963544:7:2201:16660:89809/1
  • Flowcell: HWI-ST718
  • Run: 146963544
  • Lane: 7
  • Tile: 2201
  • X-pos: 16660, Y-pos: 89809
  • /1 = first read in a pair (R1).
• Sequence: 100 bp of DNA bases.
• Quality string: ASCII characters mapping to high Phred scores (C=34, F=37, H=39, J=41) — this is excellent quality.

fastQC Report Analysis

HBR_1_R1_fastqc.html

Basic Statistics

• Filename – Your input file (HBR_1_R1.fq)
• File type – FASTQ format (possibly compressed or uncompressed)
• Encoding – Likely Illumina 1.9 (Phred+33) quality score format
• Total sequences – Total read count (number of sequences in the file)
• Filtered sequences – Number removed during pre-processing (should be 0 here)
• Sequence length – The read length (usually fixed for Illumina)
• %GC – Average GC content across reads (used later for GC-content checks)

Per base sequence quality

in your FastQC report shows the quality score for each base position across all reads.